| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.144028 |
| Chromosome: | chromosome 7 |
| Location: | 1657022 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g325350 | KIN4-3,KIN10A,KIN10-1 | Kinesin motor protein; (1 of 4) K10395 - kinesin family member 4/21/27 (KIF4_21_27) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACCTCTGCGCTGTCCGCCCCGCCGCCGA |
| Internal bar code: | ACTCTCACCCTGGCTGAGACGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 828 |
| LEAP-Seq percent confirming: | 98.9141 |
| LEAP-Seq n confirming: | 15394 |
| LEAP-Seq n nonconfirming: | 169 |
| LEAP-Seq n unique pos: | 66 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGTGTGCATGCTTGTAGTT |
| Suggested primer 2: | CCCTCAGGAATCTCATCCAA |