| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.144047 |
| Chromosome: | chromosome 7 |
| Location: | 1331778 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g322300 | XPD4,RAD3D | RAD3/XP-D family DNA-binding helicase; (1 of 1) K11273 - chromosome transmission fidelity protein 1 [EC:3.6.4.13] (DDX11, CHL1, CTF1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTACTGCCGCTGCCACCACTGCTGCTACT |
| Internal bar code: | CCGATTTAACGGAGGCATATTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 110 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCTAGCTAACATTGCCACG |
| Suggested primer 2: | CGATACCCACCATTTTACCG |