| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.144125 |
| Chromosome: | chromosome 17 |
| Location: | 5681563 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g738632 | RLS13 | RegA/RlsA-like protein; (1 of 10) IPR010919 - SAND domain-like | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAGGAGGCGGTGCCGGCATTCGGAACGGC |
| Internal bar code: | CGCAACGGTGGGGCCTAAGAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 585 |
| LEAP-Seq percent confirming: | 93.017 |
| LEAP-Seq n confirming: | 29931 |
| LEAP-Seq n nonconfirming: | 2247 |
| LEAP-Seq n unique pos: | 123 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTACCGCTCCATCAAGGTGT |
| Suggested primer 2: | ACAGAAACATTCAAACGGGC |