| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.144226 |
| Chromosome: | chromosome 10 |
| Location: | 4698591 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g453500 | RWP15 | (1 of 17) IPR003035 - RWP-RK domain; RWP-RK transcription factor | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGCAGCCGCGCCGCAGCCCGCTCGGCGA |
| Internal bar code: | TTAGGTACCTGGTAGCGGAACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 560 |
| LEAP-Seq percent confirming: | 86.061 |
| LEAP-Seq n confirming: | 1525 |
| LEAP-Seq n nonconfirming: | 247 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAATCTCAGCAGCAGGAC |
| Suggested primer 2: | GTGTGGTGATTGTTGGTGCT |