| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.144250 |
| Chromosome: | chromosome 4 |
| Location: | 3483925 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g227850 | (1 of 1) IPR004192//IPR028978 - Ubiquinol cytochrome reductase, transmembrane domain // Chorismate pyruvate-lyase/UbiC transcription regulator-associated domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAACGCCAGCTCCCCTCAGTCTCCTGCCAC |
| Internal bar code: | TCAAATTCCAACGCCACCTACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 955 |
| LEAP-Seq percent confirming: | 92.1875 |
| LEAP-Seq n confirming: | 177 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACCACCTGCATCAACACAC |
| Suggested primer 2: | TGCATGAGGTGTCAGTCCAT |