| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.144256 |
| Chromosome: | chromosome 2 |
| Location: | 1462221 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g083800 | RHM2,SNE5 | (1 of 1) K12450 - UDP-glucose 4,6-dehydratase (RHM); dTDP-glucose 4%252C6-dehydratase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTCGCATGCCGCATGGCGCACCCGCACAT |
| Internal bar code: | TGCGACGACGTGGCCGCGCTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 926 |
| LEAP-Seq percent confirming: | 99.761 |
| LEAP-Seq n confirming: | 8764 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGATGCCAGTGTGTAGCAG |
| Suggested primer 2: | AAGACCATCGATTGGTGAGC |