Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.144356 |
Chromosome: | chromosome 3 |
Location: | 3083622 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g164600 | PMA3,PMH1,ACA3 | (1 of 3) K01535 - H+-transporting ATPase (E3.6.3.6); P-type ATPase/cation transporter, plasma membrane | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGACGTCAGTGTTAACAGGGACTACAGCAC |
Internal bar code: | TGACCCTGTTTGAATTGGAGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 230 |
LEAP-Seq percent confirming: | 99.455 |
LEAP-Seq n confirming: | 365 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCGATACCTCTGTGTCAGCG |
Suggested primer 2: | GTGGTCTCGTACCTGGTGGT |