| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.144381 |
| Chromosome: | chromosome 8 |
| Location: | 1898108 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g367150 | MFT23 | Major facilitator superfamily transporter; (1 of 22) IPR011701//IPR020846 - Major facilitator superfamily // Major facilitator superfamily domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAATACGTGCAGAATACGCAGCACTGCCGT |
| Internal bar code: | TACGACCTGAGGGTCGACGGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 362 |
| LEAP-Seq percent confirming: | 99.6411 |
| LEAP-Seq n confirming: | 8606 |
| LEAP-Seq n nonconfirming: | 31 |
| LEAP-Seq n unique pos: | 45 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTCTGGTTAGCGACCTGTG |
| Suggested primer 2: | AGCCTGTAACCCCAAGTGTG |