Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.144383 |
Chromosome: | chromosome 13 |
Location: | 2060169 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g577300 | GOX13 | Glyoxal oxidase 13; (1 of 20) PTHR32208:SF21 - F10A5.18 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTCCCGCCTTCTCCTCCTCCCTCGCCCC |
Internal bar code: | TAGCAACGACCTGTTGATAATG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 773 |
LEAP-Seq percent confirming: | 99.7136 |
LEAP-Seq n confirming: | 2089 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGGTGTGCAAGTATGACCAC |
Suggested primer 2: | GACGACCTGAAATGACGGTT |