| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.144415 |
| Chromosome: | chromosome 7 |
| Location: | 4086946 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g340550 | (1 of 1) IPR001878//IPR006568 - Zinc finger, CCHC-type // PSP, proline-rich | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATATAACTGCCGCGTGTGCGCAATTGCAC |
| Internal bar code: | CTGCAAGTCGAGGTGTACGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 437 |
| LEAP-Seq percent confirming: | 94.1978 |
| LEAP-Seq n confirming: | 13069 |
| LEAP-Seq n nonconfirming: | 805 |
| LEAP-Seq n unique pos: | 55 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTCGTCAACATTCCCAAGT |
| Suggested primer 2: | GACCCACAGTTCCAACACCT |