| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.144456 |
| Chromosome: | chromosome 7 |
| Location: | 2741041 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g331250 | (1 of 1) IPR008928//IPR012336 - Six-hairpin glycosidase-like // Thioredoxin-like fold | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAGCTCCGTGTCATGTCAGTTAGAGGCAC |
| Internal bar code: | GCGGATAGAGGGATACTGCGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 166 |
| LEAP-Seq percent confirming: | 98.3312 |
| LEAP-Seq n confirming: | 3889 |
| LEAP-Seq n nonconfirming: | 66 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCTTTCCACCATAGGCCAC |
| Suggested primer 2: | CCTGTGTGTAGGGGTGTGTG |