| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.144468 |
| Chromosome: | chromosome 3 |
| Location: | 4128115 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g173350 | ANK22b,ANK22 | (1 of 1) PTHR24193//PTHR24193:SF88 - ANKYRIN REPEAT PROTEIN // SUBFAMILY NOT NAMED; Predicted protein with ankyrin repeats | gene_edge/mRNA_edge/5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTTTTAACCTGTTTGGGATGATCCTTAGA |
| Internal bar code: | GGTCGAGGGGCGAAAGGGCGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 778 |
| LEAP-Seq percent confirming: | 99.8686 |
| LEAP-Seq n confirming: | 5322 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGATCCTCCAGCATCAAT |
| Suggested primer 2: | CTGCTTACCAGGGGTCATGT |