Insertion junction: LMJ.RY0402.144481_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.144481
Chromosome:chromosome_3
Location:8328702
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre03.g199000 PHT1,PHOT,PHOT1 Phototropin sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):GTCCAGCGCTCGACCCGCGAGGTCATTGCA
Internal bar code:GTTACGTCTCCGGGCAGCGTGG

Confirmation - LEAP-Seq

LEAP-Seq distance:664
LEAP-Seq percent confirming:75.8824
LEAP-Seq n confirming:129
LEAP-Seq n nonconfirming:41
LEAP-Seq n unique pos:6

Suggested primers for confirmation by PCR

Suggested primer 1:CCATGACTGGATATGGACCC
Suggested primer 2:GGGTGCAGTACGAGTGGTTT