Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.144482 |
Chromosome: | chromosome 9 |
Location: | 3241296 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g387726 | AST1 | Aspartate aminotransferase; (1 of 1) K14454 - aspartate aminotransferase, cytoplasmic (GOT1) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCCGCCTCGCTGTACTGGCGCGCCAGCT |
Internal bar code: | TTGCGTTAGTTCGATGTATCCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 443 |
LEAP-Seq percent confirming: | 99.7015 |
LEAP-Seq n confirming: | 4008 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCTCCTGTAAGGGGAAGAG |
Suggested primer 2: | GGCAGTAAATTACGCAGGGA |