| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.144585 |
| Chromosome: | chromosome 16 |
| Location: | 5649957 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g679400 | (1 of 1) PF16501 - S phase cyclin A-associated protein in the endoplasmic reticulum (SCAPER_N) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTACGGCTCGCATTACGTTGGCGCTCTT |
| Internal bar code: | CCCATGGGCTCGGCTGACAGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 292 |
| LEAP-Seq percent confirming: | 88.7327 |
| LEAP-Seq n confirming: | 4166 |
| LEAP-Seq n nonconfirming: | 529 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTCTTATCCCTCCGGGTTC |
| Suggested primer 2: | GACCTCATCCACACACAACG |