| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.144592 |
| Chromosome: | chromosome 6 |
| Location: | 2471825 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g268800 | FLA17,IFT139,FAP60 | Intraflagellar transport protein 139; (1 of 1) PTHR14699//PTHR14699:SF0 - STI2 PROTEIN-RELATED // TETRATRICOPEPTIDE REPEAT PROTEIN 21 HOMOLOG | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGCTCACATGCCGGAGCCCATCGTATAG |
| Internal bar code: | GCAGGGATGCGTTTACACCCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 109 |
| LEAP-Seq percent confirming: | 30.7692 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAGGCACTTCTGACACAGG |
| Suggested primer 2: | TCTACCTCAACCCCGACAAC |