| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.144616 |
| Chromosome: | chromosome 13 |
| Location: | 2132523 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g577900 | (1 of 1) PF13865 - C-terminal duplication domain of Friend of PRMT1 (FoP_duplication) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCCCGCTCCTCGTGGCGGTGGTGGTGGC |
| Internal bar code: | TCCGCATGTGGGTCAGCTGTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 145 |
| LEAP-Seq percent confirming: | 99.5825 |
| LEAP-Seq n confirming: | 477 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCTGCACTGACTGCTACTC |
| Suggested primer 2: | AACGTACAGCGTGTGACTGC |