Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.144622 |
Chromosome: | chromosome 3 |
Location: | 3822212 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g170550 | POC4 | Proteome of centriole protein 4 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGGAGGACGTGTGCTGTGAGTGTTTGTGC |
Internal bar code: | CGTGATCTGATCGCATCATTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 258 |
LEAP-Seq percent confirming: | 77.005 |
LEAP-Seq n confirming: | 4484 |
LEAP-Seq n nonconfirming: | 1339 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGTCATGCTGGGATCAGTA |
Suggested primer 2: | AACCAGGTCACCATCTTTGC |