Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.144672 |
Chromosome: | chromosome 17 |
Location: | 1471705 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g706900 | CNG3 | Cyclic-nucleotide gated potassium channel; (1 of 4) IPR000595//IPR003938//IPR005821//IPR018490 - Cyclic nucleotide-binding domain // Potassium channel, voltage-dependent, EAG/ELK/ERG // Ion transport domain // Cyclic nucleotide-binding-like | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGTGGCCTCAGCTCGTAGGTGCGGCCGT |
Internal bar code: | CAATAATTCTCTAGTGTAACGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 384 |
LEAP-Seq percent confirming: | 99.8378 |
LEAP-Seq n confirming: | 3694 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACCACACACTGTGCATTCC |
Suggested primer 2: | AAGATGGGCAAGATCCACAC |