Insertion junction: LMJ.RY0402.144694_2

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.144694
Chromosome:chromosome_9
Location:4488955
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre09.g395769 FAP177 antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):GTGCTGCACAGTACGCACCTTGATTGCCAG
Internal bar code:GTATTTCGCGCCATCTTGTGTC

Confirmation - LEAP-Seq

LEAP-Seq distance:453
LEAP-Seq percent confirming:94.6429
LEAP-Seq n confirming:848
LEAP-Seq n nonconfirming:48
LEAP-Seq n unique pos:2

Suggested primers for confirmation by PCR

Suggested primer 1:CTCAGTGCTATCAAACCGCA
Suggested primer 2:CCCTCTCCTTTCCTTCCTTG