| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.144699 |
| Chromosome: | chromosome 8 |
| Location: | 4225406 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g380550 | SDR14 | (1 of 2) IPR002347//IPR013968 - Glucose/ribitol dehydrogenase // Polyketide synthase, ketoreductase domain; Short-chain dehydrogenase/reductase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGACCCCACTGGGCACTGGGCTCGCCAGA |
| Internal bar code: | TGGTCACAAGGCATTGGGCTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 89 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 63 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCGTTCGCCATTTGGTTAT |
| Suggested primer 2: | GGAGTATGTGTGCGACCCTT |