| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.144732 |
| Chromosome: | chromosome 12 |
| Location: | 8745229 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g545750 | (1 of 6) IPR000719//IPR002290//IPR011009//IPR020636 - Protein kinase domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // Calcium/calmodulin-dependent/calcium-dependent protein kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTGAATGGCGGGTGTGAAGCTGTGAACA |
| Internal bar code: | TCCGCCGGCTTCATGCCAGCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 649 |
| LEAP-Seq percent confirming: | 99.6063 |
| LEAP-Seq n confirming: | 506 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCAAACACAGAGCTGAACC |
| Suggested primer 2: | GCCTACCTGGAGTATGAGCG |