| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.144737 |
| Chromosome: | chromosome 10 |
| Location: | 2881713 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g439900 | HSP70G | ER-located HSP110/SSE-like protein; (1 of 1) K09486 - hypoxia up-regulated 1 (HYOU1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCTCCTTCTTTGTCTCCTTCTTCGGCGCC |
| Internal bar code: | GGCTCTAGACGCCGTCGGACGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 493 |
| LEAP-Seq percent confirming: | 99.422 |
| LEAP-Seq n confirming: | 516 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGGCCTTCAACAAGCTCAA |
| Suggested primer 2: | GAACGCCCATAGGATCAAGA |