| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.144773 |
| Chromosome: | chromosome 16 |
| Location: | 6367772 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g673950 | (1 of 1) 2.6.1.80 - Nicotianamine aminotransferase / Nicotianamine transaminase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGAGCGGTTGGCCGAAACCAACGGCTGGC |
| Internal bar code: | GGGACCGTTTCGAGATCTTTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 971 |
| LEAP-Seq percent confirming: | 99.7394 |
| LEAP-Seq n confirming: | 1531 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAATCCTAACGAAATGCCGA |
| Suggested primer 2: | GGAAGAATTCAGGCTAGGGG |