| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.144804 |
| Chromosome: | chromosome 1 |
| Location: | 3706099 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g023787 | ARB2 | Soluble ABC-F domain containing protein, propably cytosolic; (1 of 2) K06185 - ATP-binding cassette, subfamily F, member 2 (ABCF2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGCCGTAGCTCTCGCTGCCCTTTCGCTG |
| Internal bar code: | TATTGGACAACTAAGCGGAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 55 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 362 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACCATCCATTTCTAGCGGA |
| Suggested primer 2: | ACCGAGTGTGTGTGTGTGGT |