Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.144840 |
Chromosome: | chromosome 10 |
Location: | 3258464 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g443100 | (1 of 1) IPR001214//IPR023220 - SET domain // Type IV secretion system, VirB5-domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTGTTCTGGCCGCTGCCCTCGGACGTGT |
Internal bar code: | CGGGGGTGCTACGTTCGGGGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 774 |
LEAP-Seq percent confirming: | 99.6231 |
LEAP-Seq n confirming: | 1586 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCCTCCCACTCTGCCTTAT |
Suggested primer 2: | CACCAACAAGGCACTAAGCA |