Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.144867 |
Chromosome: | chromosome 17 |
Location: | 4128380 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g729650 | MPA15 | Metallophosphoesterase/metallo-dependent phosphatase; (1 of 1) PTHR35769:SF2 - CALCINEURIN-LIKE METALLO-PHOSPHOESTERASE SUPERFAMILY PROTEIN | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTCATTCCCGAAGTCGCCCACTAGCAGTG |
Internal bar code: | CGCGTGGACGCAGCGCGAGGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 821 |
LEAP-Seq percent confirming: | 99.669 |
LEAP-Seq n confirming: | 2710 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGACCCCTGCAGCTACTGA |
Suggested primer 2: | TCAATCGATGCTTTGTAGCG |