| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.144886 |
| Chromosome: | chromosome 11 |
| Location: | 856622 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467651 | (1 of 8) PF00211//PF01547 - Adenylate and Guanylate cyclase catalytic domain (Guanylate_cyc) // Bacterial extracellular solute-binding protein (SBP_bac_1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATTCCGCCGGTGTAGCCATGGGAGTGCCG |
| Internal bar code: | GAGTACAACCTTAGCGCGCGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 572 |
| LEAP-Seq percent confirming: | 93.4211 |
| LEAP-Seq n confirming: | 213 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCCGCTCCATGGATAACAG |
| Suggested primer 2: | CTCTGTTAGGAGGTGCCAGC |