| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.144965 |
| Chromosome: | chromosome 3 |
| Location: | 3949041 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g171650 | HEL16 | (1 of 2) PTHR18934:SF145 - ATP-DEPENDENT RNA HELICASE DHX57-RELATED; DEAD/DEAH box helicase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGCCGGGCGGCGGCGGCGGCGTGGGTAT |
| Internal bar code: | CCCTGTTTGGGGACGTGACGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 304 |
| LEAP-Seq percent confirming: | 76.0325 |
| LEAP-Seq n confirming: | 3277 |
| LEAP-Seq n nonconfirming: | 1033 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAATGGTGCTACAGCCACAG |
| Suggested primer 2: | AACATTACGCGTAGGGAACG |