Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.144989 |
Chromosome: | chromosome 6 |
Location: | 2281137 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g266900 | LPA1L | Low PSII Accumulation 1 homolog; (1 of 2) PF11998 - Protein of unknown function (DUF3493) (DUF3493) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACTTGAACTCCACGCTGTGATACACTGGT |
Internal bar code: | TATCGTGCAACCGTAGGGATTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 822 |
LEAP-Seq percent confirming: | 97.9721 |
LEAP-Seq n confirming: | 2174 |
LEAP-Seq n nonconfirming: | 45 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAAGTCCTGGTTTGAGCAGC |
Suggested primer 2: | GAAGGCCTGCTTCACAAGTC |