| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.145034 |
| Chromosome: | chromosome 6 |
| Location: | 1867568 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g263050 | EFP2 | Mitochondrial elongation factor P; (1 of 1) PTHR30053:SF1 - ELONGATION FACTOR P (EF-P) FAMILY PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGGGTACGGGTGCGCGCCGGGTTTAATC |
| Internal bar code: | GGAGGGTCTACACGACGCGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 794 |
| LEAP-Seq percent confirming: | 99.6806 |
| LEAP-Seq n confirming: | 5930 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTTTAGTTTGGGCTGGTA |
| Suggested primer 2: | GGACAACCTTGTTTGGCAGT |