| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.145114 |
| Chromosome: | chromosome 7 |
| Location: | 5677838 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g352450 | SDR10 | Short-chain dehydrogenase/reductase; (1 of 3) 1.1.1.30 - 3-hydroxybutyrate dehydrogenase / D-beta-hydroxybutyrate dehydrogenase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCACCAACTTTGCCCCCCCCCGGGAACC |
| Internal bar code: | GCCGGTGGCGTGGGCGCCATTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 943 |
| LEAP-Seq percent confirming: | 99.8962 |
| LEAP-Seq n confirming: | 2888 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAAAGGAGGACAAGGGAGC |
| Suggested primer 2: | ACCAATCAGCAATGGGAGAC |