| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.145129 |
| Chromosome: | chromosome 12 |
| Location: | 6453963 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g538100 | GST9 | Glutathione S-transferase; (1 of 3) K07393 - putative glutathione S-transferase (ECM4) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGTCCGCCTCCGTCAGCACCTCCCCGGC |
| Internal bar code: | ACACATGCCGCAGGGGAAGTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 628 |
| LEAP-Seq percent confirming: | 99.4785 |
| LEAP-Seq n confirming: | 5913 |
| LEAP-Seq n nonconfirming: | 31 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGGTGTTTGTGAACATGAC |
| Suggested primer 2: | CCTCCTGCACAAACACACAC |