| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.145200 |
| Chromosome: | chromosome 3 |
| Location: | 582625 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g145527 | RBL1 | Rhomboid-like protease; (1 of 11) 3.4.21.105 - Rhomboid protease | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCGCCTCCGCGCCTTCGTGTTTCCCGCA |
| Internal bar code: | AAGGGATAGAATACTTTGAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1145 |
| LEAP-Seq percent confirming: | 99.5608 |
| LEAP-Seq n confirming: | 6574 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTGAATGCGTGGATACGTG |
| Suggested primer 2: | GTCATCAGCACAACCACCAC |