| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.145224 |
| Chromosome: | chromosome 9 |
| Location: | 2173081 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g393200 | HSP70C | (1 of 1) K04043 - molecular chaperone DnaK (dnaK); Heat shock protein 70C | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTTAGAGTTGGGCTCTTGCCTTTTCGGCT |
| Internal bar code: | GGAACCCGTTGGAATTTTGGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 893 |
| LEAP-Seq percent confirming: | 99.8165 |
| LEAP-Seq n confirming: | 8703 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACGCTACGCTCATACCTGA |
| Suggested primer 2: | AGCCCATGGTTGTAATCGAG |