| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.145274 |
| Chromosome: | chromosome 10 |
| Location: | 5348631 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g458050 | BCA3 | Branched chain amino acid aminotransferase; (1 of 1) 2.6.1.21//2.6.1.42 - D-amino-acid transaminase / D-aspartic aminotransferase // Branched-chain-amino-acid transaminase / Transaminase B | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCGCGCCAATCAATGGCGGTATTGAAGG |
| Internal bar code: | GGTTAAAAAGTAACTGACTTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1250 |
| LEAP-Seq percent confirming: | 99.7536 |
| LEAP-Seq n confirming: | 7691 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAGGCTAGTTGCCGTACTC |
| Suggested primer 2: | GGTGGCAGTGATCGGAGTAT |