Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.145292 |
Chromosome: | chromosome 6 |
Location: | 2551035 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g269300 | CGL120 | (1 of 1) PF07103 - Protein of unknown function (DUF1365) (DUF1365); Conserved in the Green Lineage 120 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATAGAATGTTGCGCTACCGGGTGCGTCGTC |
Internal bar code: | AGTGGCGTACTCAGCGAGGCCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 898 |
LEAP-Seq percent confirming: | 98.8357 |
LEAP-Seq n confirming: | 1528 |
LEAP-Seq n nonconfirming: | 18 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGAGAGAAGCAACCATGCC |
Suggested primer 2: | ACCGCTCCACCTACCTACCT |