| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.145367 |
| Chromosome: | chromosome 10 |
| Location: | 2024966 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g432700 | SMP10 | U6 snRNA-associated Sm-like small nuclear riboprotein LSm10 (LSm2-like); (1 of 2) IPR016654 - U6 snRNA-associated Sm-like protein LSm2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCCACGGTTGCAACCCCCCAGGGCAGCA |
| Internal bar code: | GTAACCTACCTCGCGTGCCCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1155 |
| LEAP-Seq percent confirming: | 99.6936 |
| LEAP-Seq n confirming: | 6832 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACGCTGGTGTGTCTCGTAA |
| Suggested primer 2: | AGGAGCTAGCCCAGATGACA |