| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.145412 |
| Chromosome: | chromosome 2 |
| Location: | 5841287 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g111150 | ELG26 | Exostosin-like glycosyltransferase 26; (1 of 39) PTHR11062//PTHR11062:SF21 - EXOSTOSIN HEPARAN SULFATE GLYCOSYLTRANSFERASE -RELATED // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCCCATCAGAACCGGTAACCTAAAGGTA |
| Internal bar code: | GGGGACTGTAGGGAAGTGGCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 824 |
| LEAP-Seq percent confirming: | 99.8759 |
| LEAP-Seq n confirming: | 805 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAACCTCACACGCATACAC |
| Suggested primer 2: | AGCCATACACCAAGACCGAC |