Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.145435 |
Chromosome: | chromosome 13 |
Location: | 2237854 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g578600 | (1 of 1) PTHR35464//PTHR35464:SF1 - FAMILY NOT NAMED // F18O14.9 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAAAATAATCCCATACGTACCGTACGACC |
Internal bar code: | GACGGTCGGTCACGGAGGTGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 115 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 256 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCATGTGTGGGTCATGTGTG |
Suggested primer 2: | GGTAGCTTGACACGCACTCA |