Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.145563 |
Chromosome: | chromosome 3 |
Location: | 220133 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g144344 | (1 of 1) IPR003613//IPR011009//IPR013083//IPR013320 - U box domain // Protein kinase-like domain // Zinc finger, RING/FYVE/PHD-type // Concanavalin A-like lectin/glucanase domain | intron|outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTGCCCATCCACGGGTTGGCGCTCCTCC |
Internal bar code: | CAAACCTCGATTAGGGCAGGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 930 |
LEAP-Seq percent confirming: | 99.6294 |
LEAP-Seq n confirming: | 1613 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGAGTAAGGCGGTCTAGCG |
Suggested primer 2: | TATGGTGATCCCTGCTCCTC |