| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.145627 |
| Chromosome: | chromosome 3 |
| Location: | 6182967 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g192250 | PHC69 | (1 of 24) IPR003882//IPR024616 - Pistil-specific extensin-like protein // Pherophorin; Pherophorin-chlamydomonas homolog 69 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTCGGCTGCGGTAGAGGTGGCGATTGCCG |
| Internal bar code: | AATCGGGGACAGCCTAAGCCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 320 |
| LEAP-Seq percent confirming: | 64.6207 |
| LEAP-Seq n confirming: | 4106 |
| LEAP-Seq n nonconfirming: | 2248 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTGGTTTGACCGCTACCAG |
| Suggested primer 2: | GATTGTGCAAGACCTGCTGA |