| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.145705 |
| Chromosome: | chromosome 4 |
| Location: | 3697743 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g229100 | (1 of 2) 2.7.1.158 - Inositol-pentakisphosphate 2-kinase / IP5 2-kinase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGGGATCTGGGCGGCGGAAAGGAAAGGA |
| Internal bar code: | GCGGGCGGAGCGGGAGGAGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 483 |
| LEAP-Seq percent confirming: | 92.7066 |
| LEAP-Seq n confirming: | 572 |
| LEAP-Seq n nonconfirming: | 45 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAATGGCAGCTTTTAGCGTC |
| Suggested primer 2: | CAACATCCAGCACCAACAAC |