Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.145811 |
Chromosome: | chromosome 12 |
Location: | 4113342 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g518000 | SCA2,SECA2 | (1 of 1) PF01043//PF07517 - SecA preprotein cross-linking domain (SecA_PP_bind) // SecA DEAD-like domain (SecA_DEAD); Chloroplast-associated SecA protein | 3'UTR|outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCACCCTCCACGGCACTCAGAAAGCAAAG |
Internal bar code: | GGACCGGAGGGGGGCGGAGGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 818 |
LEAP-Seq percent confirming: | 99.9053 |
LEAP-Seq n confirming: | 1055 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACAGTGCGGTCCCAACTATC |
Suggested primer 2: | TCTGGAACTGGATATTGGGC |