| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.145839 |
| Chromosome: | chromosome 3 |
| Location: | 5078194 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g181200 | (1 of 1) K01969 - 3-methylcrotonyl-CoA carboxylase beta subunit (E6.4.1.4B) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCAGTCTAACGCGCAAGGCGGAAAGGCTG |
| Internal bar code: | GTTTCGCGTCCCGTGTTTGCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1181 |
| LEAP-Seq percent confirming: | 96.8254 |
| LEAP-Seq n confirming: | 122 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGTTTATGGTGCTTGGAGG |
| Suggested primer 2: | CCGTTTTGATTAATTGCCGT |