| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.145900 |
| Chromosome: | chromosome 11 |
| Location: | 2644062 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g476500 | PAO7 | Pheophorbide a oxygenase-related protein; (1 of 8) 1.14.12.20 - Pheophorbide a oxygenase / Pheide a oxygenase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCCACCCCTTCCTTCACGCCGGCCTCCT |
| Internal bar code: | CGGTTGAAAACGACGTTGCGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 658 |
| LEAP-Seq percent confirming: | 86.3329 |
| LEAP-Seq n confirming: | 5104 |
| LEAP-Seq n nonconfirming: | 808 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCTGGTGGGTCTGTCTGGT |
| Suggested primer 2: | TGCTCTTTAACACAGGTGCG |