| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.145921 |
| Chromosome: | chromosome 2 |
| Location: | 291268 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g075150 | RPB2 | (1 of 1) K03010 - DNA-directed RNA polymerase II subunit RPB2 (RPB2, POLR2B); DNA-directed RNA polymerase II, 135 kDa polypeptide | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGAGTACCGCCACAAGTACGACAGCGGCG |
| Internal bar code: | GCGTGGATCTCATTTACGTATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 125 |
| LEAP-Seq percent confirming: | 99.0461 |
| LEAP-Seq n confirming: | 623 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATGTTGGAGCCATCCTTGT |
| Suggested primer 2: | CCTACTACCAGCGCCTCAAG |