| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.146073 |
| Chromosome: | chromosome 12 |
| Location: | 103219 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g484100 | RPC19 | (1 of 1) K03020 - DNA-directed RNA polymerases I and III subunit RPAC2 (RPC19, POLR1D); DNA-directed RNA polymerase subunit | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCAATGGTGCGGTAACATCTGTCCATCT |
| Internal bar code: | CCACTCCAGGGACGAGAGCTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 617 |
| LEAP-Seq percent confirming: | 99.8935 |
| LEAP-Seq n confirming: | 938 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGGCAGTGAGGAAAGTGC |
| Suggested primer 2: | GGGGCACTACTGACCGTTTA |