Insertion junction: LMJ.RY0402.146141_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.146141
Chromosome:chromosome_1
Location:7966619
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre01.g068012 PPR5 Pentatrichopeptide repeat protein sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):GGGGCAAGAGGTGCTGCCATGAAAGCAGCA
Internal bar code:CTATCGTAAAGATGCCGCATAT

Confirmation - LEAP-Seq

LEAP-Seq distance:337
LEAP-Seq percent confirming:99.7765
LEAP-Seq n confirming:10716
LEAP-Seq n nonconfirming:24
LEAP-Seq n unique pos:11

Suggested primers for confirmation by PCR

Suggested primer 1:TGCCTTCTCTCTTCTTCCCA
Suggested primer 2:GATACACACATGACGACGGC