| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.146149 |
| Chromosome: | chromosome 8 |
| Location: | 1994924 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g367950 | FAP323 | (1 of 12) IPR000595//IPR018490 - Cyclic nucleotide-binding domain // Cyclic nucleotide-binding-like; Cyclic nucleotide-monophosphate binding domain Flagellar Associated Protein 323 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGGGTCGGCCTCCGCCAGCCCGCTGCCC |
| Internal bar code: | ACGGCCCAAGGTTAAAACACAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 473 |
| LEAP-Seq percent confirming: | 98.3659 |
| LEAP-Seq n confirming: | 14146 |
| LEAP-Seq n nonconfirming: | 235 |
| LEAP-Seq n unique pos: | 64 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCATTTCATCAAGGATCGG |
| Suggested primer 2: | AAGACAGGAGGGGTTGTGTG |